|
Thermo Fisher
gene exp bmp8b mm00432115 g1 Gene Exp Bmp8b Mm00432115 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp bmp8b mm00432115 g1/product/Thermo Fisher Average 94 stars, based on 1 article reviews
gene exp bmp8b mm00432115 g1 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Krishgen Biosystems
human spermidine genlisa tm elisa kit Human Spermidine Genlisa Tm Elisa Kit, supplied by Krishgen Biosystems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human spermidine genlisa tm elisa kit/product/Krishgen Biosystems Average 93 stars, based on 1 article reviews
human spermidine genlisa tm elisa kit - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp bmp8b rn01516089 gh Gene Exp Bmp8b Rn01516089 Gh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp bmp8b rn01516089 gh/product/Thermo Fisher Average 94 stars, based on 1 article reviews
gene exp bmp8b rn01516089 gh - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Cyagen Biosciences
lentiviral vectors carrying either bmp8b shrna (gaccctcacaaccacgtacat) or scramble shrna (cctaaggttaagtcgccctcg) Lentiviral Vectors Carrying Either Bmp8b Shrna (Gaccctcacaaccacgtacat) Or Scramble Shrna (Cctaaggttaagtcgccctcg), supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral vectors carrying either bmp8b shrna (gaccctcacaaccacgtacat) or scramble shrna (cctaaggttaagtcgccctcg)/product/Cyagen Biosciences Average 90 stars, based on 1 article reviews
lentiviral vectors carrying either bmp8b shrna (gaccctcacaaccacgtacat) or scramble shrna (cctaaggttaagtcgccctcg) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Huabio Inc
anti-bmp8b Anti Bmp8b, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-bmp8b/product/Huabio Inc Average 90 stars, based on 1 article reviews
anti-bmp8b - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cusabio
human serum samples Human Serum Samples, supplied by Cusabio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human serum samples/product/Cusabio Average 91 stars, based on 1 article reviews
human serum samples - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |