Review





Similar Products

94
Thermo Fisher gene exp bmp8b mm00432115 g1
Gene Exp Bmp8b Mm00432115 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp bmp8b mm00432115 g1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp bmp8b mm00432115 g1 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Krishgen Biosystems human spermidine genlisa tm elisa kit
Human Spermidine Genlisa Tm Elisa Kit, supplied by Krishgen Biosystems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human spermidine genlisa tm elisa kit/product/Krishgen Biosystems
Average 93 stars, based on 1 article reviews
human spermidine genlisa tm elisa kit - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp bmp8b rn01516089 gh
Gene Exp Bmp8b Rn01516089 Gh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp bmp8b rn01516089 gh/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp bmp8b rn01516089 gh - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Cyagen Biosciences lentiviral vectors carrying either bmp8b shrna (gaccctcacaaccacgtacat) or scramble shrna (cctaaggttaagtcgccctcg)
Lentiviral Vectors Carrying Either Bmp8b Shrna (Gaccctcacaaccacgtacat) Or Scramble Shrna (Cctaaggttaagtcgccctcg), supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral vectors carrying either bmp8b shrna (gaccctcacaaccacgtacat) or scramble shrna (cctaaggttaagtcgccctcg)/product/Cyagen Biosciences
Average 90 stars, based on 1 article reviews
lentiviral vectors carrying either bmp8b shrna (gaccctcacaaccacgtacat) or scramble shrna (cctaaggttaagtcgccctcg) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Huabio Inc anti-bmp8b
Anti Bmp8b, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-bmp8b/product/Huabio Inc
Average 90 stars, based on 1 article reviews
anti-bmp8b - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

91
Cusabio human serum samples
Human Serum Samples, supplied by Cusabio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human serum samples/product/Cusabio
Average 91 stars, based on 1 article reviews
human serum samples - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

Image Search Results